Arginine codon 233 (CGT) in exon 2 was changed to alanine (GCG) (ENSMUST00000037330.5:c.697_699delinsGCG p.R233A) using an sgRNA (targeting GCACGGAGGGAGTTGAACGC) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.R232A that blocks the inhibin function of the encoded peptide but preserves activin A/B production. (J:324311)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count