Trim42^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTGGAGAAATCTAGACACT and GGTGATAAACGGTTCCTGCA, which resulted in a 948 bp deletion beginning at Chromosome 9 position 97,365,460 bp and ending after 97,366,407 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000219798 (exon 2) and 250 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 114 and early truncation 2 amino acids later. (J:188991)