This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGGGCCGAGTCGGAGTCGC and CATCCGAGCTTGCAGCCGTG, which resulted in a 707 bp deletion beginning at Chromosome 2 position 93,956,403 bp and ending after 93,957,109 bp (GRCm38/mm10). This mutation deletes 707 bp from ENSMUSE00000643086 (exon 1) and is predicted to cause a change of amino acid sequence after residue 7 and early truncation 6 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count