Art5^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCGCTGTTCCTTGGTCTACG and ACATAGCTGATGCATGCAAT, which resulted in a 1029 bp deletion beginning at Chromosome 7 position 102,097,590 bp and ending after 102,098,618 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000589867 (exon 3) and 299 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 20 and early truncation 64 amino acids later. (J:188991)