A deltaCTT (TGA stop insertion) mutation is introduced just after sequences encoding amino acid 339 (exon 8) using CRISPR/cas9 methodologies (sgRNA CATTCGTCAGGAAGAAAAGG). Silent ATT to ATC (aa331) and CGT to CTA (aa332) mutations were introduced for genotyping purposes. (J:304755)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count