A L373A (nucleotide change CTC to GCC) mutation is introduced to the TBK1 recruitment motif in exon 8 using CRISPR/cas9 methodologies (sgRNA AGATGAGGTCAGTGCGGAGT). A silent CTC to CTT mutation at amino acid 371 was introduced for genotyping purposes and to prevent Cas9/gRNA from targeting already edited sequences. (J:304755)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count