A region containing Tbx5 lung enhancer Rr426, located downstream of the gene, and CTCF-binding sequence Rr108735 downstream of it, was targeted with sgRNAs (targeting ACTGGAAATCAAGACTGGGCAGG, GGAAACTGGAAATCAAGACTGGG, GGTCAGAGTCTGCCGCCCAAAGG and AAGGCCTGAGAGCGCGCCAGTGG) using CRISPR/Cas9 technology, resulting in a 1950 bp deletion (chr5:120239699-120241648 (GRCm39)). (J:335096)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count