The topologically associating domain (TAD) boundary region or insulator between Dmrt3 and Dmrt2, separating the Dmrt1/Dmrt3 TAD from the Dmrt2 TAD, was targeted with sgRNAs (targeting GAACAAGCAAGTGGGTATAAGGG, GAAAATACACTGTTTTGGGAGGG, AATCAGATATGAACGCACCAGGG and CGCACCAGGGAGCAGTATAGGGG) using CRISPR/Cas9 technology, resulting in an 11374 bp deletion (chr19:25603698-25615071(GRCm39)). (J:335096)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count