The topologically associating domain (TAD) boundary region or insulator between Fam241a and Pitx2, separating the Neurog2 TAD from the Pitx2 TAD, was targeted with sgRNAs (targeting TCACTACATCGAGTAGAACCCGG, GACATCAGTTGTAGAAAACACGG, ATCTCAAGTTAAGGGTCTGTGGG and CATCTCAAGTTAAGGGTCTGTGG) using CRISPR/Cas9 technology, resulting in a 34240 bp deletion (chr3:127763934-127798173 (GRCm39)). (J:335096)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count