The topologically associating domain (TAD) boundary region or insulator between Smad3 and Smad6, separating the Smad3 TAD from the Smad6 TAD, was targeted with sgRNAs (targeting CCTTATTGAACAGGCATCCACGG, GCTTTAAAGGGGAGACCTGAGGG, GAGTGAAACTGGGGGAATCGGGG and AGCTTGACTTAGCTACTTTGAGG) using CRISPR/Cas9 technology, resulting in an 80742 bp deletion (chr9:63749007-63829748 (GRCm39)). (J:335096)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count