An extra G nucleotide was inserted in exon 13 (ENSMUST00000109790:c.1925dupG) using two sgRNAs (targeting GGCCACCACTGCCATCGGAG and GTGGTAACCTCTCGCCCCTC) and ssODN template with CRISPR/Cas9 technology, resulting in a reading frame shift and premature stop codon shortly thereafter. This mutation is the equivalent of a human p.G643Wfs*12 mutation associated with acute myeloid leukemia (AML). (J:324868)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count