This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATATATCATTAAGCAAAAC and TTAAGGCAGGACAGTCCATC, which resulted in a 18,020 bp deletion beginning at Chromosome 5 position 110,111,841 bp and ending after 110,129,860 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001309111, ENSMUSE00001300810, ENSMUSE00001293032, ENSMUSE00000692012 (exons 2, 3 ,4 and 5) and 15,088 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count