D630039A03Rik^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTATCGGTTCCACACACAT and TGGTTGCTCATTAAGCCAGC, which resulted in a 8032 bp deletion beginning at Chromosome 4 position 57,908,342 bp and ending after 57,916,373 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000438436 and ENSMUSE00000438430 (exons 1 and 2) and 5202 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)