A guide RNA (GAAGCACTGGGGGAGGCACA) is designed to create a CAC to CGC mutation at position 47, restoring the R47H mutation to the wild-type derived H47R. ssODN repair template, gRNA, tracrRNA and CAS9 nuclease were introduced sequentially into the cytoplasm of C57BL/6-Trem2em2(TREM2*R47H)Aduci-derived zygotes with well recognized pronuclei. (J:101977)
Basic Information
C57BL/6-Trem2em2(TREM2*R47H)Aduci/J
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count