Tmsb10^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGGAGTGAGTTGTGCCGCA and TTAGGAACGCGGGCCGAGAA, which resulted in a 1282 bp deletion beginning at Chromosome 6 position 72,957,282 bp and ending after 72,958,563 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000697927 and ENSMUSE00000697926 (exons 1 and 2) and 592 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)