Arginine codon 140 (CGT) in exon 2 was targeted for change to histidine (CAT) (c.419G>A p.R140H) using an sgRNA (targeting AACGCACTGCGTAGTTGAGT) and an ssODN template with CRISPR/Cas9 technology. This allele represents an incompletely repaired sequence with a 4 bp deletion around the intended mutation (c.417_420delGCGT) that introduces a frameshift and a premature stop codon shortly thereafter (p.R140Wfs*10) and is thus a knock-out allele. (J:325410)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count