Arginine codon 140 (CGT) in exon 2 was changed to histidine (CAT) (c.419G>A p.R140H) using an sgRNA (targeting AACGCACTGCGTAGTTGAGT) and an ssODN template with CRISPR/Cas9 technology. The equivalent human mutation is associated with pontocerebellar hypoplasia type 10 (PCH10). (J:325410)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count