Ccser2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGTATTGAGAAGTGCCCCT and CAAATGCTGTTATAATAGAT, which resulted in a 465 bp deletion beginning at Chromosome 14 position 36,938,415 bp and ending after 36,938,879 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001237712 (exon 3) and 268 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 471 and early truncation 4 amino acids later. (J:188991)