Methionine codon 919 (ATG) was changed to threonine (ACC) (p.M919T) using an sgRNA (targeting CCGGATTCCCGTCAAGTGGATGG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.M918T mutation associated with multiple endocrine neoplasia type 2B (MEN2B). (J:325770)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count