Arginine codon 222 (CGT) was changed to serine (AGC) (p.R222S) using an sgRNA (targeting CAGAGCTCTCAACACTCGGAAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.R222S mutation associated with familial episodic pain syndrome (FEPS). (J:325780)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count