Guide RNAs were selected to target upstream [GACCAGATGAGGCTAGCTAA ; GCCCATTAGCTAGCCTCATC] and downstream [GTTTATAGATTGTTGGCCAT ; TATCTTCTCTTTTCTGCCCA] of exon 3. Donor DNAs were originally designed to introduce loxP sequences flanking exon 3. Il2rg transcript Il2rg-201 was used as reference for the exon number and the guide sequences. DNA sequencing of the targeted region identified a 334 nt deletion (indel mutation)[CATTGTCAGTTCAGAC//CAGAAAAGAGAAGAT]. (J:101977)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count