Tenm1^em2Tcp

This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CGGTACAGATCTATGGGCAA and TCATGGTAGATGTCACCATA targeting within ENSMUSE00000327545. This resulted in an 841bp deletion of ChrX from 41624774 to 41625614 with the insertion of T (GRCm39), introducing a frameshift and premature stop codon. (J:322048)