CRISPR/cas9 endonuclease-mediated genome editing using crRNA/tracrRNA duplex gRNA (crRNA: GAACCCACUCGGCUCAAUCAGUUUUAGAGCUAUGCU, universal tracer RNA: AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU) is designed to insert an N-terminal double HA tag immediately downstream of the initial Met start codon with SerGlyGly as the linker peptide. (J:335573)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count