This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATCAAGTACCATCTAAGTG and TTATGTAAGTACATTGTCAG, which resulted in a 3744 bp deletion beginning at Chromosome X position 136,858,051 bp and ending after 136,861,794 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000409412 (exon 3) and 199 bp of flanking intronic sequence including the splice acceptor and start site and is predicted to result in a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count