CRISPR/cas9 endonuclease-mediated genome editing is used to insert a double stop codon (TGATGA) downstream of the initator ATG in in exon 2. The sgRNA (GGAACACAGGGCCAGTTGA(GGG), and ssODN donor (CAGTCTCGTGAATGAGCTTTCTTCTTCCAGGTTCCGATTCAATGCAAAGAACACAGGGCCTCACTAGGGTGTCT CTGTTTCTTGGCTTTGTAAAGGTG) were used. (J:101977)
Basic Information
FVB.129P2-Pde6b+ Tyrc-ch/AntJ
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count