Proline codon 43 (CCC) was changed to serine (AGT) (p.P43S), glutamic acid codon 164 (GAA) to glycine (GGC) (p.E164G) and aspartic acid codon 380 (GAC) to histidine (CAC) (p.D380H) using sgRNAs (targeting GCACAGGTATGGGGTCAGCG, AAGCTCTCTAAATGAATCTT and AGGACAGTACTTCAGAGACA) and ssODN templates with CRISPR/Cas9 technology. These mutations change the mouse residues to the residues found in the orthologous human gene (S43, G162, H410). (J:327275)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count