Histidine codon 109 (CAT) was changed to arginine (CGC) (p.H109R) and glycine codon 910 (GGC) to serine (TCC) (p.G910S) using sgRNAs (targeting CATTTGCATGTTTCCTTTCA and TTTCTGAATGAACTTCTGTC) and ssODN templates with CRISPR/Cas9 technology. These mutations change the mouse residues to the residues found in the orthologous human gene (R159, S1086). (J:327275)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count