Arginine codon 67 (AGG) was changed to lysine (AAA) (p.R67K) using an sgRNA (targeting CAAATTTTGATATTACTAAA) and an ssODN template with CRISPR/Cas9 technology. This mutation changes the mouse residue to the residue found in the orthologous human gene. (J:327275)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count