CRISPR/Cas9 technology using sgRNAs GCTATCCATCGTGACGACTC and GCCACGAGGGACTTTGCAT generated a knock-out allele. Several founders were generated (number 4, 6, 8, 9, 10, and 11). The pound symbol (#) is used when line is not specified and/or lines are pooled. (J:335209)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count