CRISPR/cas9 endonuclease-mediated genome editing is used to create an aspartate to alanine substitution at codon 262 in exon 2. The mutation is changes the aspartate residue needed for cellular DNA activity to an inactive alanine. The crRNA and tracrRNA sequences are as follows; crRNA #1 for D/A on Exon 2, sequence (AGCCACTCTGCAGGGAGTCG), crRNA #2 for D/A on Exon 3, sequence (ACATGAACCCCTGATTGACG); tracrRNA. (J:335226)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count