This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCGAAGAAGAGCGTGGCCCT and CTTCAGCGCCCGGGTTCCCC, which resulted in a 1457 bp deletion beginning at Chromosome 3 position 96,597,496 bp and ending after 96,598,952 bp (GRCm38/mm10). This mutation deletes 1457 bp from ENSMUSE00000410687 (exon 2) and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 24 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count