This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes / injecting Cas9 mRNA with single guide RNAs with spacer sequences AAGAACTGTGGAGCTACGGC and GTATTGCTTCCAATCCGGCA targeting within exon ENSMUSE00000614088. This resulted in a 919bp deletion of Chr12 from 61886383 to 61887301 (GRCm39) introducing a frameshift and premature stop codon. (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count