Mmgt1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAGCTCCTTTTTTTTTCTG and GCGAGACCAATGGGGAGACG, which resulted in a 12794 bp deletion beginning at Chromosome X position 56,585,378 bp and ending after 56,598,171 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000436074, ENSMUSE00000364351, ENSMUSE00000412050, ENSMUSE00000366591 (exons 1-4) and 8560 bp of flanking intronic sequence including the splice acceptor start site and splice donor and is predicted to result in a null allele. (J:188991)