Proline codon 847 (CCG) in exon 12 was changed to leucine (CTG) (p.P847L) using an sgRNA (targeting GACGATCTGCCCTACCCGTTTGG) and an ssODN template (TATGTGCTATGTCCCCGCACAGGTCAGGAGCGCATGGTGATAGCTGACGATCTGCCCTACCTGTTTGGCCTGACTCAATATAGCGATTACATCTACTGGACTGACTGGAACCTGCATAGCATT) with CRIPSR/Cas9 technology. The equivalent human mutation (p.P848L) is found in some familial exudative vitreoretinopathy (FEVR) patients. (J:328283)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count