Dpy19l4^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTACAGCAAGCGCTTAGAC and AAGAATACCCTACAAACAGC, which resulted in a 1497 bp deletion beginning at Chromosome 4 position 11,303,116 bp and ending after 11,304,612 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001291800, ENSMUSE00001305659, ENSMUSE00000385379 (exons 4, 5, 6) and 1138 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 83 and early truncation 84 amino acids later. 61 bp before the deletion site there is an indel with 2 bp insertion (AA) and 5 bp deletion (CTGCT). (J:188991)