Serine codon 832 (TCC) in exon 28 was changed to alanine (GCC) (p.S832A) using an sgRNA (targeting CCTTGCCAGGAGTTACTGCG) and ssODN template with CRISPR/Cas9 technology. This mutation prevents phosphorylation of the residue. (J:328338)
Basic Information
(C57BL/6 X DBA/2)F1 x C57BL/6
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count