Isoleucine codon 228 (ATT) in exon 6 was changed to methionine (ATG) using two sgRNAs (targeting ATTCCAGGTAAGAAGTGATTGG and CACACCAATCACTTCTTACCTGG) and an ssODN template (CAGCTCTTCGAACTTTCAGAGTCTTGAGAGCTTTGAAAACTATTTCCGTTATGCCGGGAAAGAAGTGATTGGTGTGGAGCTTTAGACTGCTCAACTCCAGCTG) using CRISPR/Cas9 technology. The equivalent human mutation is associated with small fiber neuropathy (SFN). (J:329231)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count