Best3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTGGGTGCATAACACCCGG and AATACTTCCAAGGAGCCTGA, which resulted in a 469 bp deletion beginning at Chromosome 10 position 117,002,370 bp and ending after 117,002,838 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000101368 (exon 5) and 314 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 161 and early truncation 54 amino acids later. (J:188991)