Exon 8 was targeted with an sgRNA (targeting TCCTGACTTCTCCAGACTTG) and an ssODN template (CCGTCCCCTGTATTCCAACCCACCTCTCAATGGGGCCCGGATCGCAGCAACCATTCTGACGTCTCCGGATTTAGGTAAGCAATGGTAACGATTACTAGCTGTTCCGTGCTACAGCTCCATGAATGGAAAAG) using CRISPR/Cas9 technology to change arginine codon 337 (CGG) to glycine (GGT) (p.R337G, c.1009_1011CGG>GGT). The equivalent human mutation (p.Arg337Gly c.1009C>G) is found in some Malate-Aspartate Shuttle (MAS)-Related Encephalopathy patients. (J:291216)
Basic Information
either: C57BL/6J or (C57BL/6J x C3H/HeJ)F1
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count