Exon 8 was targeted with an sgRNA (targeting TCCTGACTTCTCCAGACTTG) and an ssODN template (CCGTCCCCTGTATTCCAACCCACCTCTCAATGGGGCCCGGATCGCAGCAACCATTCTGACGTCTCCGGATTTAGGTAAGCAATGGTAACGATTACTAGCTGTTCCGTGCTACAGCTCCATGAATGGAAAAG) using CRISPR/Cas9 technology with the aim to create a p.R337G mutation. The actual result was an unintended insertion/duplication of a single T (A on forward strand, after chr8:96596111 (GRCm39)), which results in a frameshift and premature stop codon. (J:291216)
Basic Information
either: C57BL/6J or (C57BL/6 x C3H)F1
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count