Two guide RNAs (ATTGTGGACCATTCAGCTTG and CTTAACTATGTAGTCCAGAC) are designed to target exon 3. Non-homologus endjoining results in the deletion of the sequence between the gRNAs. Klrg1 transcript Klrg1-201 (ENSMUST00000032207.9) was used as reference for exon number and the guide sequences. (J:334818)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count