The nuclear localization signal sequence was targeted with an sgRNA (targeting GTACAAGCCAAAAGAACGTAAGG) and an ssODN template (GCATTAGGGGTGAGGAAGGTACTCTCGGATTTCATCTAATCTCTCCAACTTTTTTTTTCCAGCCTGACTCAGTACGCGCCAGCAGAACGTAAGGATATTGGTAACTGAGGGCTGGGGTAGAAGGATGCATGTGGCAGGAATCGCCTAGCAGATTGCTAGG) using CRISPR/Cas9 technology, resulting in lysine codon 399 (AAG) to alanine (GCG) (K399A) and lysine codon 401 (AAA) to alanine (GCA) (K401A) mutations. These mutations destroy the NLS. (J:331728)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count