CRISPR-targeting, using two sgRNAs (targeting CTACTACTTGGCAGGTTGGAGGG and GTCAAAGGGACCTGGTAGTTTGG), removed the endothelial/endocardial enhancer located -50kb upstream of the Klf2 gene transcription initiation site (chr8:72266979-72269534; mm10). This allele contains a 4.3 kb deletion/400 bp insertion encompassing all of the 2556 bp size enhancer. (J:333400)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count