Armc10^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTAGCGCCTCCCCTCCCAC and GGATAGCTAAGAGTTCAGAA, which resulted in a 482 bp deletion beginning at Chromosome 5 position 21,648,332 bp and ending after 21,648,813 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000602887 (exon 2) and 333 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 44 and early truncation 4 amino acids later. There is a 7 bp (CCCCCCC) insertion at the deletion site. (J:188991)