Two guide RNAs (cggtcccccactgagaactcagg and gatgttggtcctacaagactggg) are used to insert loxP sites upstream of exon 4 and downstream of exon 29. Gene ID: 13717; NM_007925 is used as reference for exon number and the guide sequences. (J:298415)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count