This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAATACCTTTACTGTGGCA and GCTTAATTTTTTAGACTGTG, which resulted in a 4206 bp deletion beginning at Chromosome 18 position 52,483,514 bp and ending after 52,487,719 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000143087 and ENSMUSE00000143081 (exons 4 and 5) and 4052 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 76 and early truncation 191 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count