Leucine codon 104 (TTA) in exon 4 was changed to proline (CCA) (p.L104P) using gRNAs (targeting GGCGGTTGGCTTGTTAGATGTGG and CCAAGGCGGTTGGCTTGTTAGAT) and an ssODN template (AACCTGATGAATAATCTTTTGATGATTTTGGTTTTCTTGCAGTCTAAAGCCGTTGGCTTGCCAGACGTCGAcGTGTATGGTCCTTCCATTCCAAAGATGATGAACCTGAGAGGAAATCCA) with CRISPR/Cas9 technology. The orthologous human mutation is associated with mitochondrial complex I deficiency disorder. (J:333699)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count