CRISPR/Cas9 technology using sgRNAs 5 AATATGTGGGCAAGCTGGGTTGG 3 AND 5GAAATGGTACCTTTGATTAAGG 3 generated an approximate 20 kb deletion at intron 17. This is similar to a deletion identified in an individual on the autism spectrum. Both Nrxn1alpha and Nrxn1gamma transcript levels are unaffected while Nrxn1beta levels are slightly reduced in homozygous males but not in females. (J:334083)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count