Tyrosine codon 1070 (TAT) was changed to phenylalanine (TTC) (p.Y1070F) through an AT>TC mutation in exon 14 or 15 (depending on splice variant) using an sgRNA (targeting TCCACGCATACTGTCACCTA) and ssODN template (ATCTCCACGCATACTGTCACCTTCGGCAAC) with CRISPR/Cas9 technology. This mutation prevents phosphorylation of the residue. (J:334279)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count