CRISPR targeting of exon 3 using sgRNAs AAATCGTCCCATTCCACAATGG and GAAGGTCTTGTGAGAAGCCATG produced small deletions. Three mouse lines, with a 1-bp, 11-bp, and 13-bp deletions were generated. The pound (#) in the allele symbol is used for this pooled allele. (J:333015)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count